Tanggal :September 22, 2020

bpy9. Counting k-mer words in Python

Spread the love

The function count, below, will find the number of times a pattern appears.

For every position in text, minus length of pattern, it checks for equality with pattern, and returns the total number of equalities.


# bpy9.py

from __future__ import print_function, division
import numpy as np

def rand_dna(n):
dna = ['A','C','T','G']
seq = np.random.choice(dna,n)
return "".join(seq)

def count(text, pattern):
cnt = 0
for i in range(len(text)-len(pattern)):
if text[i:i+len(pattern)] == pattern: cnt+=1
return cnt

np.random.seed(34)
dna = rand_dna(50)
dna_pattern = rand_dna(3)
c = count(dna, dna_pattern)
print("dna = ",dna)
print("dna_pattern = ", dna_pattern)
print("c =",c)

# dna = CTTCTCAGCGTTCTCCACTCTACATCAGGCCGAAGTCAATTCATCTTTGT
# dna_pattern = CTT
# c = 2
Share

Leave a Reply

Your email address will not be published. Required fields are marked *